api.ilepbase.com

BLAST

Sequence similarity search and available BLAST databases (requires SequenceServer deployment).

BLAST endpoints are optional and depend on a deployed SequenceServer instance. When disabled, requests return 503 with BLAST_NOT_CONFIGURED.

Database IDs are SequenceServer hashes returned by GET /blast/databases (not folder names like COI_db).

GET /api/v1/blast/databases

List available BLAST databases.

curl https://api.ilepbase.com/api/v1/blast/databases

Response (200)

{
  "success": true,
  "data": {
    "databases": [
      {
        "id": "a8ec2c5af1fbcab6b092a01f7acf8936",
        "title": "iLepBase COI BOLD nucleotide database",
        "type": "nucleotide",
        "sequenceCount": 2040921
      },
      {
        "id": "6c35a7dfb3730d44121898615f99b43e",
        "title": "iLepBase Lepidoptera protein database",
        "type": "protein",
        "sequenceCount": 42491179
      }
    ]
  },
  "timestamp": "2026-05-21T08:45:24.243Z"
}

POST /api/v1/blast/search

Submit a sequence for BLAST. Returns synchronously when the job completes within BLAST_SYNC_TIMEOUT (default 30s); otherwise returns 202 with a jobId for polling.

curl -X POST https://api.ilepbase.com/api/v1/blast/search \
  -H "Content-Type: application/json" \
  -d '{
    "sequence": "AACATTATATTTTATTTTTGGTATTTGAGCTGGTATAATTGGAACTTCTTTAAGATTATTAATTCGGGCAGAATTAGGTAATCCAGGATCTTTAATTGGGGATGATCAAATTTATAATACAATTGTTACTGCACATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGACTAA",
    "program": "blastn",
    "database": "a8ec2c5af1fbcab6b092a01f7acf8936",
    "evalue": "1e-5",
    "maxHits": 2
  }'

Request Body

FieldTypeRequiredDescription
sequencestringYesQuery sequence (FASTA or raw).
programstringYesblastn, blastp, blastx, tblastn, tblastx.
databasestringYesDatabase id from /blast/databases.
evaluestringNoE-value threshold (default 1e-5).
maxHitsintNoMax alignments (default 50).

Response — sync (200)

{
  "success": true,
  "data": {
    "mode": "sync",
    "results": {
      "program": "blastn",
      "database": "",
      "hits": [
        {
          "id": "GWOSX749-11|COI-5P|Australia|...",
          "title": "lasiocamparia,None",
          "length": 658,
          "hsps": [
            {
              "bitScore": 370.45,
              "score": 200,
              "evalue": "6.67678e-101",
              "identity": 200,
              "queryFrom": 1,
              "queryTo": 200,
              "hitFrom": 1,
              "hitTo": 200,
              "alignLen": 200,
              "gaps": 0,
              "querySeq": "...",
              "hitSeq": "...",
              "midline": "|||||..."
            }
          ]
        }
      ],
      "stats": {
        "dbNum": 2040921,
        "dbLen": 1323196554,
        "queryLen": 200
      }
    }
  },
  "timestamp": "2026-05-21T08:45:24.623Z"
}

Response — async (202)

{
  "success": true,
  "data": {
    "mode": "async",
    "jobId": "3fa85f64-5717-4562-b3fc-2c963f66afa6",
    "status": "running",
    "message": "Query is taking longer than expected. Poll for results."
  },
  "timestamp": "2026-05-21T08:45:30.000Z"
}

GET /api/v1/blast/jobs/{jobId}

Poll BLAST job status (async searches). Only the submitter IP may access the job.

curl https://api.ilepbase.com/api/v1/blast/jobs/3fa85f64-5717-4562-b3fc-2c963f66afa6

Response (200)

{
  "success": true,
  "data": {
    "jobId": "3fa85f64-5717-4562-b3fc-2c963f66afa6",
    "status": "succeeded",
    "program": "blastn",
    "database": "a8ec2c5af1fbcab6b092a01f7acf8936",
    "results": { "program": "blastn", "hits": [], "stats": { "dbNum": 2040921, "dbLen": 1323196554, "queryLen": 200 } },
    "createdAt": "2026-05-21T08:45:20.000Z",
    "finishedAt": "2026-05-21T08:45:35.000Z"
  },
  "timestamp": "2026-05-21T08:45:36.000Z"
}

Synced with Postman collection iLepBase API.

On this page

GET /api/v1/blast/databasesPOST /api/v1/blast/searchGET /api/v1/blast/jobs/{jobId}