api.ilepbase.com

MMNet

Multimodal species identification from specimen image and DNA barcode (rate limited per IP).

MMNet uses a trained deep learning model to predict insect species from specimen photographs and/or DNA barcode sequences. Supported species include Spodoptera frugiperda, Helicoverpa armigera, Ostrinia furnacalis, and others (30 classes total).

No authentication required. Rate limited to 3 concurrent requests per IP.


POST /api/v1/mmnet/identify

Identify insect species using multimodal inference (specimen image + DNA barcode).

Accepts multipart/form-data:

FieldTypeRequiredDescription
imagefileYesSpecimen photo (JPEG/PNG/WebP, max 10 MB).
barcodestringNoDNA barcode sequence (IUPAC nucleotide symbols).
modestringNomultimodal_fusion (default when barcode provided) or sequence_only.
top_kintNoNumber of top predictions to return (1–10, default 5).
curl -X POST https://api.ilepbase.com/api/v1/mmnet/identify \
  -F "image=@specimen.jpg" \
  -F "barcode=ACGTACGTACGTACGTACGTACGTACGTACGTACGT" \
  -F "mode=multimodal_fusion" \
  -F "top_k=5"

Response (200)

{
  "success": true,
  "data": {
    "request_id": "a1b2c3d4-e5f6-7890-abcd-ef1234567890",
    "model_version": "mmnet-gpm-epoch60",
    "mode": "multimodal_fusion",
    "latency_ms": 284.2,
    "prediction": {
      "class_index": 6,
      "label": "Spodoptera frugiperda",
      "score": 0.93
    },
    "top_k": [
      { "class_index": 6, "label": "Spodoptera frugiperda", "score": 0.93 },
      { "class_index": 5, "label": "Spodoptera exigua", "score": 0.04 }
    ],
    "sequence_contribution": 0.61,
    "image_contribution": 0.39
  },
  "timestamp": "2026-05-21T12:00:00.000Z"
}

Error: 429 Too Many Requests

{
  "success": false,
  "error": {
    "code": "CONCURRENT_LIMIT_REACHED",
    "message": "Maximum concurrent identification requests per IP reached."
  },
  "timestamp": "2026-05-21T12:00:00.000Z"
}

GET /api/v1/mmnet/health

Check the health and readiness of the MMNet species identification service. Returns model version, class count, device info, and readiness status.

curl https://api.ilepbase.com/api/v1/mmnet/health

Response (200)

{
  "success": true,
  "data": {
    "status": "ready",
    "model_version": "mmnet-gpm-epoch60",
    "class_count": 30,
    "device": "cpu"
  },
  "timestamp": "2026-05-21T12:00:00.000Z"
}

On this page